<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	>

<channel>
	<title>Morocco Blogs &#187; French Morocco Blogs</title>
	<atom:link href="http://moroccoblogs.com/category/french-morocco-blogs/feed/" rel="self" type="application/rss+xml" />
	<link>http://moroccoblogs.com</link>
	<description>The Best of Morocco Blogs, Bloggers, News, Travel, Culture, and Life in al-Maghreb</description>
	<lastBuildDate>Sun, 26 Feb 2012 12:37:37 +0000</lastBuildDate>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	<generator>http://wordpress.org/?v=3.3.1</generator>
		<item>
		<title>Agharass has been nominated for Best Non-English and Best Photo Blog</title>
		<link>http://moroccoblogs.com/agharass-has-been-nominated-for-best-non-english-and-best-photo-blog/</link>
		<comments>http://moroccoblogs.com/agharass-has-been-nominated-for-best-non-english-and-best-photo-blog/#comments</comments>
		<pubDate>Wed, 05 Jan 2011 12:21:48 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[Best of Morocco Blogs]]></category>
		<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[Morocco Pictures]]></category>
		<category><![CDATA[best french blog Morocco]]></category>
		<category><![CDATA[best photo blog Morocco]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=1556</guid>
		<description><![CDATA[Another last minute nomination. Just another day to get your nominations in.]]></description>
			<content:encoded><![CDATA[<p>Another last minute nomination. Just another day to get your nominations in.<br />
<img alt="morocco door knocker" src="http://farm6.static.flickr.com/5241/5296018847_73465cdb9a_z.jpg" title="Arghass" class="alignleft" width="640" height="425" /></p>
<p><a rel="nofollow" href="http://agharass.com/">Agharass.com</a>  has been nominated for the best Non-English Blog and also for best Photo Blog at the subdomain <a rel="nofollow" href="http://portfolio.agharass.com/">portfolio.agharass.com</a></p>
<div id="attachment_1231" class="wp-caption alignleft" style="width: 160px"><a href="http://moroccoblogs.com/nominations-for-the-2011-best-of-morocco-blogs-are-now-open/nominated/" rel="attachment wp-att-1231"><img src="http://moroccoblogs.com/wp-content/uploads/2010/09/NOMINATED-150x150.gif" alt="Best of Morocco Blogs" title="NOMINATED - Best of Morocco Blogs" width="150" height="150" class="size-thumbnail wp-image-1231" /></a><p class="wp-caption-text">Wouldn't you like to put this badge on your site? Wouldn't it be even better to put Winner?</p></div>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/agharass-has-been-nominated-for-best-non-english-and-best-photo-blog/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Casablanca4Life has been nominated for the Best of Morocco Blogs (Non-English)</title>
		<link>http://moroccoblogs.com/casablanca4life-has-been-nominated-for-the-best-of-morocco-blogs-non-english/</link>
		<comments>http://moroccoblogs.com/casablanca4life-has-been-nominated-for-the-best-of-morocco-blogs-non-english/#comments</comments>
		<pubDate>Mon, 03 Jan 2011 13:37:39 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[Best of Morocco Blogs]]></category>
		<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[Casablanca lifestyle]]></category>
		<category><![CDATA[Morccan lifestyle]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=1550</guid>
		<description><![CDATA[This awesome lifestyle blog covers all aspects of modern life in Casablanca and urban Morocco. 
]]></description>
			<content:encoded><![CDATA[<p>Casablanca for life has been nominated for the Best of Morocco Blogs in the Category of Non-English Blogs. </p>
<p><img src="http://2.bp.blogspot.com/_Qt1j8UiH5CA/TRhdnwasCeI/AAAAAAAABFE/tYgmSf7-h0U/s400/Capture1.JPG" alt="Lifestyle Casablanca" /></p>
<p>This awesome lifestyle blog covers all aspects of modern life in Casablanca and urban Morocco. </p>
<p><a rel="nofollow" href="http://casablanca4life.blogspot.com/">Casablanca4Life</a></p>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/casablanca4life-has-been-nominated-for-the-best-of-morocco-blogs-non-english/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Blog de Rachid Jankari &#8211; Je partage, donc j&#8217;existe</title>
		<link>http://moroccoblogs.com/blog-de-rachid-jankari-je-partage-donc-jexiste/</link>
		<comments>http://moroccoblogs.com/blog-de-rachid-jankari-je-partage-donc-jexiste/#comments</comments>
		<pubDate>Tue, 20 Apr 2010 09:56:41 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[Morocco Culture]]></category>
		<category><![CDATA[IT Maroc]]></category>
		<category><![CDATA[IT Morocco]]></category>
		<category><![CDATA[Morocco Press]]></category>
		<category><![CDATA[Morocco technology]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=683</guid>
		<description><![CDATA[The French language blogs in Morocco often offer something that we miss in the English blogs, a sense of what it is like to be Moroccan. Rachid Jankari&#8217;s blog while being primarily a personal blog, also offers insight into the world of technology, news, and politics, from a Moroccan perspective. http://www.jankari.org/ A recent post shows [...]]]></description>
			<content:encoded><![CDATA[<p>The French language blogs in Morocco often offer something that we miss in the English blogs, a sense of what it is like to be Moroccan. Rachid Jankari&#8217;s blog while being primarily a personal blog, also offers insight into the world of technology, news, and politics, from a Moroccan perspective.</p>
<p><a rel="nofollow" href="http://www.jankari.org/">http://www.jankari.org/</a><br />
<img src="http://agharass.com/wp-content/uploads/2009/09/3891775179_958d344c4b.jpg" alt="Morocco Geeks" /><br />
A recent post shows why I believe the future of Morocco lies in technology:<br />
(French)</p>
<blockquote><p>La version anglaise de ce post sur Talk Morocco</p>
<p>Que faut-il pour qu’une liberté réelle de la presse, puisse s’établir au Maroc? Une question épineuse. Mais qui s’impose surtout dans un contexte préoccupant. Les atteintes à la liberté d’expression dans les médias et sur internet semblent prendre un tournant préoccupant ces deux dernières années.</p>
<p>Certes, le Maroc a enregistré un élargissement du périmètre d’expression au niveau de la presse écrite et internet depuis le début des années 2000. Néanmoins, l’enjeu est de taille. S’agit-il d’un retour en arrière ou bien d’embûches de parcours compte tenu des affaires récentes qui ont secoué la sphère médiatique marocaine.<br />
La situation des libertés au Maroc est comparable à celle d’une grossesse de huitième mois. Un mois critique qui risque d’entraîner une fausse couche faute de réformes courageuses et de respect des libertés.</p>
<p>Ma préoccupation ne se limite pas à l’espace réel des médias “traditionnels” : presse écrite, radio, TV…, mais j’estime qu’il faut préserver la liberté d’expression et de “navigation” et de publication sur la toile pour enrayer le label “pays ennemi de l’internet”.<br />
Au-delà de la réforme du code la presse, qui s’impose, c’est une prédisposition des acteurs politiques, du plus haut niveau, à réaliser une mutation vers une approche démocratique et constitutionnelle qui transcende la logique de sacralité vers celle de l’Etat de droit. C’est le seul moyen en mesure de permettre au Royaume de consolider et booster son leadership régional.</p>
<p>La réforme politique doit être aussi la résultante d’une action concertée et soutenue de la société civile et des acteurs de l’écosystème des médias et de l’internet. Cette action de pression et de plaidoirie doit explorer tous les moyens légaux en mesure de faire prévaloir le cahier revendicatif lié à la préservation de la liberté d’expression offline et online.</p>
<p>Comparé à beaucoup d’autres pays arabes et musulmans, je pense que le Maroc a beaucoup d’atouts pour aller de l’avant dans la dynamique de développement humain, économique et politique. Nous devrons profiter de nos pré-requis pour conquérir une place de choix dans échiquier régional et international d’ici l’horizon 2050. Un objectif qui ne peut être atteint sans liberté de presse et accès libre à l’internet. Une liberté online et offline à la hauteur de nos ambitions.</p></blockquote>
<p>English (translated)</p>
<blockquote><p>What does it take for a real freedom of the press to settle in Morocco? A thorny issue. But who needed especially in a context of concern. Attacks on freedom of expression in the media and the Internet seem to be turning a worrying past two years.</p>
<p>While Morocco has seen a widening of the scope of expression in the press and internet since the early 2000s. Nevertheless, the stakes are high. Is this a step backwards or many pitfalls of course given the recent cases that have rocked the Moroccan media sphere.<br />
The situation of freedoms in Morocco is similar to that of an eighth month of pregnancy. One month review that could lead to a miscarriage because of courageous reforms and respect for freedoms.</p>
<p>My concern is not limited to the actual space of &#8220;traditional&#8221; media: print, radio, TV &#8230; but I think it must preserve freedom of expression and &#8220;navigation&#8221; and published on the Web to stop the label &#8220;enemy country to the Internet.<br />
Beyond reform the press code, which is needed is a predisposition of political actors, the highest level, to achieve a transformation to a democratic and constitutional approach that transcends the logic of sacredness to that of the &#8216;rule of law. It is the only means able to allow the Kingdom to consolidate and boost its regional leadership.</p>
<p>Political reform must also be the result of a concerted and sustained civil society actors and the media ecosystem and the Internet. This action of pressure and advocacy must explore all legal means in a position to uphold the terms of demands related to the preservation of freedom of expression online and offline.</p>
<p>Compared to many other Arab and Muslim countries, I think that Morocco has many strengths to move forward in the dynamics of human development, economic and political. We will take our pre-requisite to gain a place in regional and international scene by 2050. A goal can be achieved without freedom of press and free access to the Internet. A free online and offline to match our ambitions.</p></blockquote>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/blog-de-rachid-jankari-je-partage-donc-jexiste/feed/</wfw:commentRss>
		<slash:comments>1</slash:comments>
		</item>
		<item>
		<title>Blog of Anas Alaoui &#8211; C&#8217;est la moment</title>
		<link>http://moroccoblogs.com/blog-of-anas-alaoui-cest-la-moment/</link>
		<comments>http://moroccoblogs.com/blog-of-anas-alaoui-cest-la-moment/#comments</comments>
		<pubDate>Sat, 10 Apr 2010 08:20:55 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[Uncategorized]]></category>
		<category><![CDATA[Anais Alaoui]]></category>
		<category><![CDATA[Boudnib]]></category>
		<category><![CDATA[c'est la moment]]></category>
		<category><![CDATA[Errachidia]]></category>
		<category><![CDATA[Femmes violées]]></category>
		<category><![CDATA[Kafka]]></category>
		<category><![CDATA[Maroc]]></category>
		<category><![CDATA[Victime]]></category>
		<category><![CDATA[Violence]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=667</guid>
		<description><![CDATA[This is another great French language blog. Anais writes consistently and well about the history, politics, culture, economy, and social issues. http://www.anasalaoui.com/ Check out this recent post to see why we love this blog: French Il est des fois où l’on ne sait plus où donner de la tête face à un flot d’informations. Il [...]]]></description>
			<content:encoded><![CDATA[<p>This is another great French language blog. Anais writes consistently and well about the history, politics, culture, economy, and social issues.<br />
<a rel="nofollow" href="http://www.anasalaoui.com/"></p>
<p>http://www.anasalaoui.com/</a></p>
<p><img src="http://www.anasalaoui.com/wp-content/uploads/2010/02/irreversible-207x300.jpg" alt="Anas Alaoui" /><br />
Check out this recent post to see why we love this blog:</p>
<p>French</p>
<blockquote><p>Il est des fois où l’on ne sait plus où donner de la tête face à un flot d’informations. Il est des fois où l’on ne sait quoi penser quand le choquant le dispute au sordide.</p>
<p>Ce matin, je consultais ma revue de presse habituelle quand je suis tombé sur un de ces articles qui ne permet qu’une seule première réaction: pousser une bonne gueulante !</p>
<p>Sur le site internet du journal arabophone Akhbar Al-Youm est rapportée l’information selon laquelle une jeune fille de la localité de Boudnib, province d’Errachidia, a été la victime (je reviens sur ce terme un peu plus tard) d’un viol collectif de la part de sept individus, dont l’age va de 17 à 30 ans. Ne s’arrêtant pas en si bon chemin, ceux-ci ont même filmé la scène sur téléphone portable selon le même journal.</p>
<p>Quatre des sept suspects ont été appréhendés par la police en fin de semaine dernière et déférés à la justice sous l’accusation de Rapt, Viol, Enregistrement et partage d’une vidéo contenant des images impudiques. Les services de police cherchent encore les trois autres suspects.</p>
<p>Ce qui est surprenant dans l’histoire est que la jeune fille n’a pas porté plainte dès le départ de peur de la honte et du discrédit qu’un tel viol peut porter sur elle et sur sa famille. La police n’a en fait réagi qu’une fois l’enregistrement du viol partagé et retiré du site de partage de vidéo Youtube et après que les suspects l’aient partagé avec un grand ombre de personnes sur leurs portables via Bluetooth.</p>
<p>Je vous passe les détails de la vidéo rapportés dans l’article et que vous pouvez toujours lire directement sur le site du journal. Des détails, certes sordides et choquants mais d’où transpirent la violence de la scène. On ne peut qu’être « mal à l’aise », excusez l’euphémisme, quand on lit la description faite de la vidéo. Cela est déchirant, cela a un goût âpre qui paralyse l’échine. La description terrifiante d’un mécanisme déréglé où tout fout le camp, où l’humain, en dernier ressort, se retranche derrière ses instincts primaires. Un sentiment d’une perte irrémédiable de valeurs et de repères.</p>
<p>Mais le plus choquant reste la chose suivante: la jeune fille, ie la victime est poursuivie pour « Non dénonciation ». Oui, vous avez bien lu. Elle est également poursuivie. Cela ne s’invente pas !</p>
<p>Histoire d’être sûr de mon français, je me suis précipité vers le premier dictionnaire et j’y ai consulté le terme victime. Le Larousse donne la définitions suivante:</p>
<p>    adjectif et nom féminin. Qui a subi un mal, un dommage : Victime d’un vol. Qui pâtit, qui subit les effets d’une situation, d’événements, de choses néfastes.</p>
<p>Je me serais attendu à une réaction de désapprobation de notre société étant donné son conservatisme et son ignorance. En effet, Le viol demeure encore un sujet tabou au sein de la société marocaine. Loin de recevoir le soutien moral et les encouragements de leurs familles, les victimes sont souvent rejetées. Les parents considèrent le viol d’une fille comme un déshonneur qu’il faut cacher à tout prix.<br />
D’ailleurs, le nombre exact de femmes victimes de viols au Maroc reste inconnu, pour la simple raison que peu d’entre elles en parlent, elles subissent la loi du silence.</p>
<p>Au lieu de s’attendre à un soutien légitime et qui de plus est normal de la part de ceux qui sont censés protéger les victimes, bien au contraire ils la poursuivent pour non dénonciation.</p>
<p>Je me doutais que Kafka avait du sang marocain, là j’en suis sûr.</p></blockquote>
<p>English (translation)</p>
<blockquote><p>There are times when we do not know where to head against a flood of information. There are times when we do not know what to think when the disputes turn shockingly sordid.</p>
<p>This morning, I looked at my press reviews when I came across one of those items which allows only one first reaction: throwing up!</p>
<p>On the website of the Arabic-language newspaper Akhbar Al-Youm there was information about a young girl from the town of Boudnib, Errachidia province, who was the victim (I return to this term later) of a gang rape from seven individuals, whose ages range from 17 to 30 years. As if that isn&#8217;t enough, they have even filmed the scene on mobile phone.</p>
<p>Four of the seven suspects were apprehended by the police last weekend and brought to justice on charges of Kidnapping, Rape, recording and sharing video containing indecent images. The police are still seeking three other suspects.</p>
<p>What is surprising in the story is that the girl did not complain at the outset for fear of shame and stigma that such a rape can carry on her and her family. The police have in fact reacted only after recording of rape and removed from the shared sharing site YouTube and video after the suspects had shared with a large number of people on their phones via Bluetooth.</p>
<p>I&#8217;ll spare you the details reported in the video section and you can always read directly on the journal&#8217;s web site. Details admittedly sordid and shocking because of the  violence of the scene. One can only  be &#8220;uncomfortable&#8221;, excuse the euphemism, when one reads the description of the video. This is heartbreaking, it has a bitter taste that has crippled the spine. The terrifying description of a disordered mechanism where humans, ultimately, were hiding behind primary instincts. A sense of irretrievable loss of values.</p>
<p>But the most shocking thing is the following: the girl, ie the victim is being sued for &#8220;not reporting&#8221;. Yes, you read correctly. It is also continued. This can not be invented!</p>
<p>History to be sure of my French, I rushed to the first dictionary and I viewed the term victim. The Larousse gives the following definitions:</p>
<p>    adjective and noun. Who has suffered a bad injury: Victim of a robbery. Who suffers, who suffers the effects of a situation, events, things adverse.</p>
<p>I would have expected a reaction of disapproval since Morocco is still steeped in conservatism and ignorance. Indeed, rape is still taboo in Moroccan society. Far from receiving moral support and encouragement of their families, victims are often rejected. Parents consider rape a girl as a disgrace that should be hidden at all costs.<br />
Moreover, the exact number of women victims of rape in Morocco is still unknown for the simple reason that few of them speak, they suffer the silence.</p>
<p>Instead of the expected support which is more normal from those who are supposed to protect victims, on the contrary they continue to denunce them.</p>
<p>I suspect that Kafka was by blood, a Moroccan.</p></blockquote>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/blog-of-anas-alaoui-cest-la-moment/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Like a Bottle Thrown into the Sea</title>
		<link>http://moroccoblogs.com/like-a-bottle-thrown-into-the-sea/</link>
		<comments>http://moroccoblogs.com/like-a-bottle-thrown-into-the-sea/#comments</comments>
		<pubDate>Sun, 04 Apr 2010 13:45:35 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[larbi]]></category>
		<category><![CDATA[like a bottle thrown into the sea]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=661</guid>
		<description><![CDATA[We love these French blogs. Often they are on the very edge of getting into trouble in Morocco. They are political, poetic, witty, and a lot of fun. Take for example the following: Comme une bouteille jetée à la mer! (Like a Bottle thrown into the sea) Larbi.org Chikhate Oued Zem Vs Miloud El Arbaoui [...]]]></description>
			<content:encoded><![CDATA[<p>We love these French blogs. Often they are on the very edge of getting into trouble in Morocco. They are political, poetic, witty, and a lot of fun. Take for example the following:<br />
<img src="http://www.larbi.org/public/201003/arbaoui.jpg" alt="Larbi.org" /><br />
Comme une bouteille jetée à la mer! (Like a Bottle thrown into the sea)<br />
<a rel="nofollow" href="http://www.larbi.org/">Larbi.org</a></p>
<p>Chikhate Oued Zem Vs Miloud El Arbaoui<br />
French:</p>
<blockquote><p>Retour à notre plateau, où l’ami du roi et sa sainte lumière sont décidés à rallier tout ce que le Maroc compte d’habitants et à avoir un sympathisant dans chaque famille.</p>
<p>Commençons par une prière. « Ssi Fouad qui êtes (après Sa Majesté) au dessus de tout. Que votre parti soit sanctifié, que votre gouvernance arrive, que votre volonté soit faite sur ce qui reste du paysage politique. Donnez-nous le pain de chaque jour. Remettez-nous nos dettes comme nous les remettons à ceux qui vous sont proches. Pardonnez les offenses des nihilistes comme nous pardonnons aussi à ceux qui vous ont offensés. Ne nous abandonnez plus jamais seuls, mais délivrez-nous du mal. Ainsi soit-il. »</p>
<p>Après avoir rendu grâce, nous pouvons commencer. Bienvenue ! Gloire à nos valeurs sacrées. On ira droit au but : nous allons donc écouter une déclaration historique. </p>
<p>Nous avons en effet une bonne nouvelle à annoncer : Frère Fouad a reçu cette semaine un soutien de taille qui devrait largement jouer en sa faveur et lui assurer un plébiscite et élargir sa base déjà bien remplie. Il s’agit d’un grand poète, un des rares artistes marocains connu au-delà des frontières, le grand Miloud El Arbaoui qui vient de composer une chanson à la gloire de frère Fouad et son parti</p></blockquote>
<p>English Translation:</p>
<blockquote><p>Back to our board, where a friend of the king and his holy light are determined to rally all that Morocco has a population and have a supporter in every family.</p>
<p>Let&#8217;s start with a prayer. &#8220;Ssi Fouad who are (after His Majesty) above all. Whether your party is sanctified, that your housekeeper come, Thy will be done on what remained of the political landscape. Give us our daily bread. Forgive us our debts as we forgive those who are close to you. Forgive offenses nihilists as we forgive those who trespass against you. Do not abandon us never alone, but deliver us from evil. Amen. &#8221;</p>
<p>After giving thanks, we can begin. Welcome! Glory to our sacred values. We&#8217;ll go straight to the point we&#8217;re going to listen to a historic declaration.</p>
<p>We have indeed good news to announce: Brother Fouad received this week a support size that should play heavily in his favor and to ensure a plebiscite and expand its base already busy. This is a great poet, one of the few artists Moroccan known beyond the borders, the great Miloud El Arbaoui who just composed a song in praise of his brother Fuad</p></blockquote>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/like-a-bottle-thrown-into-the-sea/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>EnissayPoint.net</title>
		<link>http://moroccoblogs.com/enissaypoint-net/</link>
		<comments>http://moroccoblogs.com/enissaypoint-net/#comments</comments>
		<pubDate>Sat, 27 Mar 2010 12:39:45 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[Improving your Morocco Blog]]></category>
		<category><![CDATA[blogs in morocco]]></category>
		<category><![CDATA[make money blogging]]></category>
		<category><![CDATA[moroccan bloggers]]></category>
		<category><![CDATA[Morocco Blogs]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=648</guid>
		<description><![CDATA[EnissayPoint.net Here&#8217;s a blog in French that is all about how to make your blog better and how to earn money with your blog. Here is a bit about Yassine Sarjad, the author of this blog: French: Yassine Sarjad, une personne vachement amusante, un ami de la communauté, participant au championnat international de combat ultime [...]]]></description>
			<content:encoded><![CDATA[<p><a rel="nofollow" href="http://www.enissaypoint.net">EnissayPoint.net</a><br />
<img src="http://farm4.static.flickr.com/3554/3414296328_e99c6fbd63_m.jpg" alt="Yassine Sarjad" /><br />
Here&#8217;s a blog in French that is all about how to make your blog better and how to earn money with your blog. Here is a bit about Yassine Sarjad, the author of this blog:</p>
<p>French:</p>
<blockquote><p>Yassine Sarjad, une personne vachement amusante, un ami de la communauté, participant au championnat international de combat ultime , membre de la Fondation ‘Sauvons les baleines’, l’homme qui contrôle le marché noir des peaux de bébés phoques et membre de la fondation “Papa Mfinda ».
</p></blockquote>
<p>Translation into English:</p>
<blockquote><p>Yassin Sarjad is a damn fun person, a friend of the community, participating in international championship ultimate fighting, a member of the Foundation &#8216;Save the Whales&#8217;, the man who controls the black market baby seal pelts and a member of the foundation &#8220;Papa Mfinda.&#8221;</p></blockquote>
<p>Here is his most recent post:</p>
<p>French</p>
<blockquote><p>Ils disent toujours que le blogging est déjà saturé. Saturé sûrtout si tu vas utiliser le blogging pour viser une large audience et ensuite gagner de l’argent. J’observe toujours la blogsphère et alors que je ne peut pas prétendre qu’il ya suffisamment de blogs en ligne sur un certain sujet, je pense que c’est pas encore assez pour dire que c’est saturé.</p>
<p>J’ai toujours classé les blogueurs en trois catégories, il y a ceux que nous appelons blogueurs professionnels, il y a les bons blogueurs, et il y a les mauvais blogueurs. Les blogueurs pro sont ceux considérés comme des experts, ceux qui sont fameux ou simplement les « célébrités du web ». Les bon blogueurs sont ceux qui font les choses de la bonne façon mais sont pas encore aussi populaires que les blogueurs professionnels. Et évidemment les mauvais blogueurs ou les polluants, qui représentent la majorité de toute la blogosphère.</p>
<p>Ok, j’avoue que le mot ‘polluants’ est un peu rude mais malheureusement, la plupart des gens ne réalisent pas qu’ils font parti de cette catégorie. Dans cet article, je vais donner une liste de 10 signes qui prouvent justement que tu es un mauvais blogueur. Sans plus tarder, les voici.</p>
<p>1. Tu n’as pas un objectif (et des objectifs spécifiques)</p>
<p>fixer des objectifs est une nécessité très importante dans chaque entreprise. Et le blogging c’est une entreprise sur le web, tu as donc besoin d’en avoir aussi. Quand je demande aux gens quel est leur but, leur réponse habituelle est faire de l’argent. la plupart des gens mettent seulement un objectif de longue haleine général et le problème c’est que presque tous le temps, il n’est pas atteint.<br />
à suivre..</p></blockquote>
<p>English Translation:</p>
<blockquote><p>
They always say that blogging is already saturated. Saturated especially if you&#8217;re going to use blogging to target a broad audience and then make money. Always observe the blogosphere, and while I can not pretend that there are enough blogs online on a certain topic, I think it&#8217;s still not enough to say that it is saturated.</p>
<p>I always classified into three categories bloggers, there are those we call professional bloggers, there are good bloggers, and there are bad bloggers. The pro bloggers are those considered experts, who are famous or simply &#8220;web celebrities&#8221;. The good bloggers are people who do things the right way but not yet as popular as professional bloggers. And of course the bad bloggers or pollutants, which represent the majority of the entire blogosphere.</p>
<p>Ok, I admit that the word &#8216;pollution&#8217; is a little rough, but unfortunately most people do not realize they are part of this category. In this article I will give a list of 10 signs that prove just that you&#8217;re a bad blogger. Without further ado, here they are.</p>
<p>1. You do not have a goal (and targets),</p>
<p>Yargets are a very important necessity in every company. And blogging is a business on the web, then you need to have too. When I ask people what their purpose, their usual response is to make money. Most people require only an objective of long-term general and the problem is that almost all the time, it is not reached.
</p></blockquote>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/enissaypoint-net/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Souvenirs oubliés- The Blog of Imane Tirich</title>
		<link>http://moroccoblogs.com/souvenirs-oublies-the-blog-of-imane-tirich/</link>
		<comments>http://moroccoblogs.com/souvenirs-oublies-the-blog-of-imane-tirich/#comments</comments>
		<pubDate>Wed, 03 Mar 2010 06:49:03 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[blogs in French]]></category>
		<category><![CDATA[Morocco Blogs]]></category>
		<category><![CDATA[photography blogs]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=415</guid>
		<description><![CDATA[Here is another wonderful Moroccan Blog that comes to you after the hard work of our translators: http://imane.agafix.org/blog This blog is about life experiences and everyday stories, this blog relies on photography and plays a lot with pictures as the proverb says a picture is worth a thousand words. Posted by Imane on Dec 15th, [...]]]></description>
			<content:encoded><![CDATA[<p>Here is another wonderful Moroccan Blog that comes to you after the hard work of our translators:</p>
<p><a rel="nofollow" href="http://imane.agafix.org/blog">http://imane.agafix.org/blog</a></p>
<p>This blog is about life experiences and everyday stories, this blog relies on photography and plays a lot with pictures as the proverb says a picture  is worth a thousand words.</p>
<p><img src="http://imane.agafix.org/wp-content/themes/ePhoto/timthumb.php?src=http://imane.agafix.org/wp-content/uploads/2009/12/papilllon.jpg&#038;h=200&#038;w=200&#038;zc=1&#038;q=65" alt="blog of Imane Tirich" /></p>
<blockquote><p>Posted by Imane on Dec 15th, 2009.<br />
Je n’arrive pas à dormir, ou plutôt je n’ai pas envie de dormir , j’allume la télé en espérant de trouver quelque chose d’intéressant à suivre … tac tac tac tactactactactactactactactactactac … la pluie commence à tomber intensément ce qui fait perdre la réception, j’éteins alors la télé , et j ouvre la fenêtre . Aahhhh, cette odeur m’a beaucoup manquée , je ferme mes yeux , je respire profondément , très très profondément , quelle joie et quel régal ! C’est féérique et super magique ce qu’il fait de moi ce beau
</p></blockquote>
<p>Translation in English:</p>
<blockquote><p>Forgotten memories</p>
<p>I can not sleep, or rather I did not want to sleep, I turn on the TV hoping to find something interesting to follow &#8230; tock &#8230; tick tock tactactactactactactactactactactac rain begins to fall heavily making lose the reception, then turn off the TV, and I opened the window. Aahhhh, the smell I missed a lot, I close my eyes, I breathe deeply, very deeply, what joy and what a treat! It is magical and super magic that made me this beautiful.
</p></blockquote>
<p>Imane has this to say about her blog:</p>
<blockquote><p>Mes idées ont été embastillées depuis longtemps dans ma tête. Elles avaient la possibilité d’en sortir, mais elles vénéraient s’évanouir dans l&#8217;obscurité que de scintiller dans le monde extérieur … Jusqu’ à l’arrivée d’un objet qui les a déblayées et les a rendues très pétulantes en les déléguant en une &#8220;matière visuelle &#8220;, c&#8217;est un appareil photos numérique , peut être son modèle n’est pas très professionnel , mais elle est au moins capable de traduire mes idées et ma façon de voir les choses à des belles images susceptibles de transmettre aisément mes messages aux autres ! C’est grâce à cet objet que je donne la vie à ce blog en escomptant que la transmission des messages sera parfaite.</p></blockquote>
<p><strong>English Translation:</strong></p>
<blockquote><p>My ideas were imprisoned for a long time in my head. They were able to escape, but they venerated to vanish in the darkness rather than sparkle in the outside world &#8230; Until the arrival of an object that has cleared them away and made them very petulant by delegating into a &#8220;visual field&#8221;, It is a digital camera, may be its type is not very professional, but it is at least able to translate my ideas and my way of seeing things with beautiful images, capable of transmitting easily my messages to others! It is this object that I give life to this blog in the expectation that the transmission of messages will be perfect.</p></blockquote>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/souvenirs-oublies-the-blog-of-imane-tirich/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>J&#039;écris parce que je chante mal   (French)</title>
		<link>http://moroccoblogs.com/jecris-parce-que-je-chante-mal-french/</link>
		<comments>http://moroccoblogs.com/jecris-parce-que-je-chante-mal-french/#comments</comments>
		<pubDate>Thu, 18 Feb 2010 09:56:39 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[Morocco News]]></category>
		<category><![CDATA[Jecris parce que je chante mal]]></category>
		<category><![CDATA[Nowbi]]></category>
		<category><![CDATA[overblog]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=285</guid>
		<description><![CDATA[We are constantly looking for the best blogs in Morocco, in any language. That&#8217;s why we will now be bringing you the best Morocco blogs that we can find in French and Arabic too. Our first non-English blog is a fine example of why you should use that google &#8216;translate this page&#8217; button. J&#8217;écris parce [...]]]></description>
			<content:encoded><![CDATA[<p>We are constantly looking for the best blogs in Morocco, in any language. That&#8217;s why we will now be bringing you the best Morocco blogs that we can find in French and Arabic too.  Our first non-English blog is a fine example of why you should use that google &#8216;translate this page&#8217; button.</p>
<p><img src="http://t2.gstatic.com/images?q=tbn:fh6iJQyChfBUSM:http://idata.over-blog.com/0/08/82/08/lmouhim.jpg" alt="Nowbi, overblog, Jecris parce que je chante mal" /><br />
<a href="http://nowbi.over-blog.com">J&#8217;écris parce que je chante mal</a>  ( I write because I sing badly)</p>
<p>This is a blog about society, criticism and philosophy. It&#8217;s a place where Nawfal Chana shares his feelings, sadness, bad and good experiences, and everything else he wants.</p>
<p>Nawfal Chana wrote this as a description of his blog:</p>
<p>(French)</p>
<blockquote><p>Bienvenu dans mon blog qui traite un peux de tout, beaucoup de rien, humeur de jour, lecons, réflections, quéstions, doutes, hypothèses, spiritualites, joies,  peines,amour, colère, coup de Coeur, coup de gueule, hier, demain, aujourd&#8217;hui..Histoire, culture…Passé, future et présent…et toute turpitudes de mon âme distillés au fil de mes écrits.
</p></blockquote>
<p>(English)</p>
<blockquote><p>Welcome to my blog. It deals with a lot of things, nothing much, mood of the day, lessons, reflections, questions, doubts, hypotheses, spirituality, joys, sorrows… Love, anger, affairs of the heart, affairs of the emotion, yesterday tomorrow, today… history and culture … past, future and present … and all my soul&#8217;s turpitude distilled through my writings.</p></blockquote>
<p>Here is a sample post the lead in post from this well written blog:<br />
(French)</p>
<blockquote><p>Nowbi ne guérit pas le cancer, n&#8217;a pas de recette pour maigrir sans régime, n&#8217;a pas la solution aux conflits du Moyen-Orient. Vous n&#8217;apprendrez pas ici comment marcher sur l&#8217;eau, ni comment éviter les péages ou comment tromper l&#8217;ennui. Il n&#8217;a pas la prétention de faire de ses lecteurs de brillants citoyens, n&#8217;a toujours pas appris à cuisiner, ne sait pas de quoi demain sera fait, pas même aujourd&#8217;hui, ne prétend pas pouvoir en finir avec la pauvreté en Afrique, il n&#8217;a même pas réussi à en finir avec ses études. Par contre, il trouve que cela peut être utile de vivre avec un peu d&#8217;humour, beaucoup de coeur et de laisser le dernier mot à la raison. Si ce que j&#8217;écris vous plait, n&#8217;hésitez pas à me contacter. De même, si vous ne m&#8217;aimez pas du tout, si vous avez des remarques, des critiques, n&#8217;hésitez pas à les gardez pour vous. Si vous écrivez en SMS, mettez « SMS » dans le sujet de votre mail, ça sera plus facile pour moi de le supprimer. Nowbi, un blog réputé pour sa réputation qui offre un regard masculin et au singulier sur ce qui l&#8217;entoure. Des textes qui se veulent parfois prétentieux, vicieux, pessimistes, ridicules, impertinents, hypocrites, lâches et laids; tout comme vous. Un blog qui vous rassemble et vous ressemblez. Pour avoir la force de faire face à ce que nous sommes, parce qu&#8217;un jour il faudra apprendre à se respecter. Bonjour chez vous, Nawfel, d&#8217;en face. De l&#8217;autre coté du miroir</p></blockquote>
<p>(English)</p>
<blockquote><p>Nowbi is not a cure of cancer, has no recipe for weight loss without dieting, it&#8217;s not the solution to conflicts in the Middle East. You will not learn how to walk on water here, nor how to avoid tolls or how to alleviate your boredom. It is not intended to make readers of brilliant people, has still not learned to cook, does not know what tomorrow will bring, not even today, does not claim power to end poverty in Africa, it has not even managed to end of mystudies. By contrast, you might find that it may be helpful to live with a little humor, a lot of heart and leave the last word to the reason. If what I write pleases you do not hesitate to contact me. Similarly, if you do not love me at all, if you have any comments, criticisms, please keep them to yourself. If you write in &#8221;SMS&#8221;, highlight &#8221;SMS&#8221; in the subject of your mail, it will be easier for me to delete it. Nowbi is a blog known for its reputation, both masculine and alone. Texts which are intended sometimes pretentious, vicious, pessimistic, ridiculous, irrelevant, hypocritical, cowardly, ugly, just like you. A blog that brings you together and that you look like. We must have the strength to face what we are, because one day we will learn respect. Hello to you, Nawfel, opposite. On the other side of the mirror.</p></blockquote>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/jecris-parce-que-je-chante-mal-french/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
		<item>
		<title>Je pense , donc j&#039;ecris (French)</title>
		<link>http://moroccoblogs.com/je-pense-donc-jecris-french/</link>
		<comments>http://moroccoblogs.com/je-pense-donc-jecris-french/#comments</comments>
		<pubDate>Sun, 14 Feb 2010 14:16:43 +0000</pubDate>
		<dc:creator>admin</dc:creator>
				<category><![CDATA[French Morocco Blogs]]></category>
		<category><![CDATA[French blog Morocco]]></category>
		<category><![CDATA[I think therefore I write]]></category>
		<category><![CDATA[Je pense donc j'ecris]]></category>

		<guid isPermaLink="false">http://moroccoblogs.com/?p=371</guid>
		<description><![CDATA[Here we have another fine example of a blog that English readers might have missed if not for the hard work of our translators. The blog title translates as I think, therefore I write. This blog is about chronicles, sharing stories, reflections and events, it’s a diverse blog where you can read and enjoy different [...]]]></description>
			<content:encoded><![CDATA[<p>Here we have another fine example of a blog that English readers might have missed if not for the hard work of our translators. The blog title translates as</p>
<p><img src="http://i47.tinypic.com/etaaeg.jpg" alt="Muslim Morocco Blog" /></p>
<p><a rel="nofollow" href="http://boubouh.over-blog.com">I think, therefore I write. </a></p>
<p>This blog is about chronicles, sharing stories, reflections and events, it’s a diverse blog where you can read  and enjoy different topics in different languages; Arabic, French and English.</p>
<p>The owner of this blog Aymane Boubouh wrote this as a description:</p>
<blockquote><p>Il y a exactement un an et demi que je m&#8217;aventure dans le blogging qui m&#8217;a permis de satisfaire partiellement un coté journalistique en moi … raconter des aventures de voyages et des pensées à un public qu&#8217;on ne connais pas donne de l&#8217;importance au vécu et aux idées de chacun , favorise l&#8217;échange culturel et réduit le dégrée de la domination médiatique préfabriquée en faveur de l&#8217;information réelle et indépendante … le blogging m&#8217;a donné l&#8217;occasion de me faire des amis dans la divergence de nos points de vues … il me permet aussi de véhiculer l&#8217;information qui me parrait  juste en faisant des copier/coller à des articles et vidéos que je trouve interessant sur le net pour lutter d&#8217;une part contre une désinformation manipulatrice et d&#8217;autre part contre un divertissement médiatique abêtissant !!</p></blockquote>
<p>English Translation</p>
<blockquote><p>There is exactly one year and a half that I venture into blogging, which allowed me to partially satisfy a journalistic side in me &#8230; telling travel adventures and thoughts to an audience that we don’t not know gives the importance to the lives and ideas of everyone, promotes cultural exchange and reduces the degree of prefabricated media domination in favor of real and independent information &#8230; blogging has given me the opportunity to make friends in the divergence of our views &#8230; it also allows me to convey the information that I  like by just doing copy / paste articles and videos that I find interesting on the net to fight  on one hand against manipulative misinformation and  on the other hand against a stultifying media entertainment!</p></blockquote>
]]></content:encoded>
			<wfw:commentRss>http://moroccoblogs.com/je-pense-donc-jecris-french/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
		</item>
	</channel>
</rss>

